• Erickson Aarup posted an update 6 hours, 17 minutes ago

    Thus, there is an emergent need for developing therapeutic approaches to prevent and reverse retinal neurovascular dysfunction with exposure to ischemic stroke.With multidrug-resistant bacterial pathogens on the rise, there is a strong research focus on alternative antibacterial treatments that could replace or complement classical antibiotics. Metallic nanoparticles, and in particular silver nanoparticles (AgNPs), have been shown to kill bacterial biofilms effectively, but their chemical synthesis often involves environmentally unfriendly by-products. Recent studies have shown that microbial and plant extracts can be used for the environmentally friendly synthesis of AgNPs. Herein we report a procedure for producing AgNPs using a putative Cedecea sp. strain isolated from soil. The isolated bacterial strain showed a remarkable potential for producing spherical, crystalline and stable AgNPs characterized by UV-visible spectroscopy, transmission electron microscopy, dynamic light scattering, and Fourier transform infrared spectroscopy. The concentration of produced nanoparticles was 1.31 µg/µl with a negative surface charge of - 15.3 mV and nanoparticles size ranging from 10-40 nm. The AgNPs was tested against four pathogenic microorganisms S. epidermidis, S. aureus, E. coli and P. aeruginosa. The nanoparticles exhibited strong minimum inhibitory concentration (MIC) values of 12.5 and 6.25 µg/µl and minimum bactericidal concentration (MBC) values of 12.5 and 12.5 µg/mL against E. coli and P. aeruginosa, respectively. One distinguishing feature of AgNPs produced by Cedecea sp. extracts is their extreme stability. Inductively coupled plasma mass spectrometry and thermogravimetric analysis demonstrated that the produced AgNPs are stable for periods exceeding one year. This means that their strong antibacterial effects, demonstrated against E. coli and P. aeruginosa biofilms, can be expected to persist during extended periods.CRISPR/Cas9 represents a valuable tool to determine protein function, but technical hurdles limit its use in challenging settings such as cells unable to grow in vitro like primary leukemia cells and xenografts derived thereof (PDX). To enrich CRISPR/Cas9-edited cells, we improved a dual-reporter system and cloned the genomic target sequences of the gene of interest (GOI) upstream of an out-of-frame fluorochrome which was expressed only upon successful gene editing. To reduce rounds of in vivo passaging required for PDX leukemia growth, targets of 17 GOI were cloned in a row, flanked by an improved linker, and PDX cells were lentivirally transduced for stable expression. The reporter enriched scarce, successfully gene-edited PDX cells as high as 80%. Using the reporter, we show that KO of the SRC-family kinase LYN increased the response of PDX cells of B precursor cell ALL towards Vincristine, even upon heterozygous KO, indicating haploinsufficiency. In summary, our reporter system enables enriching KO cells in technically challenging settings and extends the use of gene editing to highly patient-related model systems.In the present study, we analyze a field-based seven-year data series of surface mass-balance measurements collected during 2011/12 to 2017/18 on Naradu Glacier, western Himalaya, India. The average annual specific mass balance for the said period is  - 0.85 m w.e. with the maximum ablation of  - 1.15 m w.e. The analysis shows that the topographic features, south and southeast aspects and slopes between 7 to 24 degrees are the reasons behind the maximum ablation from a particular zone. The causes of surface mass balance variability have been analyzed through multiple linear regression analyses (MLRA) by taking temperature and precipitation as predictors. The MLRA demonstrates that 71% of the observed surface mass balance variance can be explained by temperature and precipitation. It clearly illustrates the importance of summer temperature, which alone explains 64% variance of surface mass balance. Wnt agonist 1 The seasonal analysis shows that most of the surface mass balance variability is described by summer temperature and winter precipitation as two predictor variables. Among monthly combinations, surface mass balance variance is best characterized by June temperature and September precipitation.Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.Acoustic holograms are the keystone of modern acoustics. They encode three-dimensional acoustic fields in two dimensions, and their quality determines the performance of acoustic systems. Optimisation methods that control only the phase of an acoustic wave are considered inferior to methods that control both the amplitude and phase of the wave. In this paper, we present Diff-PAT, an acoustic hologram optimisation platform with automatic differentiation. We show that in the most fundamental case of optimizing the output amplitude to match the target amplitude; our method with only phase modulation achieves better performance than conventional algorithm with both amplitude and phase modulation. The performance of Diff-PAT was evaluated by randomly generating 1000 sets of up to 32 control points for single-sided arrays and single-axis arrays. This optimisation platform for acoustic hologram can be used in a wide range of applications of PATs without introducing any changes to existing systems that control the PATs.