The c.2051dupA (p. Tyr684Ter) mutation of the PKD2 gene probably underlay the pathogenesis of ADPKD in this pedigree.

The c.2051dupA (p. Tyr684Ter) mutation of the PKD2 gene probably underlay the pathogenesis of ADPKD in this pedigree.

To explore the genetic basis for three children patients with CHARGE syndrome.

The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.

All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo.

Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.

Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.

To explore the genetic basis of four Chinese families affected with deafness.

All probands were subjected to next generation sequencing (NGS). Suspected variant were verified by Sanger sequencing among the family members. Prenatal diagnosis was provided for three couples through Sanger sequencing.

All probands were found to carry pathogenic variants of the TMC1 gene, which included c.100C>T (p.R34X) and c.642+4A>C in family 1, c.582G>A (p.W194X) and c.589G>A (p.G197R) in family 2, c.1396_1398delAAC and c.1571T>C (p.F524S) in family 3, and homozygosity of c.2050G>C (p.D684H) in family 4. All parents were heterozygous carriers of the variants. The c.642+4A>C and c.1571T>C (p.F524S) were unreported previously. Prenatal diagnosis revealed that none of the fetuses were affected. Follow-up confirmed that all newborns had normal hearing.

Variant of the TMC1 gene probably underlay the deafness in the four families. Above findings have enhanced our understanding of the function of the TMC1 gene and enriched its variant spectrum. The results also facilitated genetic counseling and prenatal diagnosis for the families.

Variant of the TMC1 gene probably underlay the deafness in the four families. Above findings have enhanced our understanding of the function of the TMC1 gene and enriched its variant spectrum. The results also facilitated genetic counseling and prenatal diagnosis for the families.

To analyze the results of concurrent hearing and deafness genetic screening and follow up of newborns.

In total 33 911 babies born to 5 designated hospitals in Nanshan District of Shenzhen city from October 2017 to December 2019 were included. All subjects underwent concurrent hearing and deafness genetic screening covering 21 variants of 4 genes including GJB2, SLC26A4, GJB3 and Mt12SrRNA. For those with positive results, Sanger sequencing was carried out for confirmation.

93.32% subjects passed the first-round hearing screening, and 87.01% passed the recheck testing. The overall detection rate was 4.18%. Proteasome inhibitor The detection rates for GJB2, SLC26A4, GJB3 and Mt12srRNA variants were 1.98%, 1.58%, 0.37% and 0.25%, respectively. 126 and 84 subjects were found with high risk for delayed-onset and drug-induced hearing loss, respectively. In addition, 4 and 5 subjects were found to harbor homozygous/compound heterozygous variants of the GJB2 and SLC26A4 genes, respectively. Concurrent screening showed that subjectxaminations. Sanger sequencing and next-generation sequencing are critical for ascertain the diagnosis.

Concurrent newborn genetic screening can enhance the effectiveness of hearing screening and enable earlier identification and intervention for children with hearing impairment. Follow-up can improve the diagnostic rate for children who are positive for the concurrent screening. Nevertheless, genetic and hearing screening cannot replace the diagnostic testing. It is necessary to conduct comprehensive analysis for the results of genetic and hearing screening and radiological examinations. Sanger sequencing and next-generation sequencing are critical for ascertain the diagnosis.β-thalassemia is a type of inherited hemolytic anemia caused by decreased globin production due to defect of the HBB gene. The pathogenesis of the disease is imbalance of α/β globin chains. The excess of α-globin chains will form hemichromes which can damage red blood cell membranes and lead to hemolysis, ineffective erythropoiesis, and secondary iron overload. Iron overload in turn can cause complications such as growth retardation, liver cirrhosis, cardiac insufficiency, and aggravate the disease phenotype. In recent decades, genes participating in iron metabolism have been discovered, and the mechanism of iron metabolism in the development of thalassemia has gradually been elucidated. Subsequently, by manipulating the expression of key genes in iron metabolism such as hepcidin and transferrin receptor, researchers have revealed that iron restriction can improve ineffective hematopoiesis and iron overload, which may provide a potential approach for the treatment of thalassemia. This article reviews the progress of research on iron metabolism-related genes and related pathways in β-thalassemia.

To investigate the serological and molecular characteristics of a pedigree carrying an allele for ABO*BW.11 blood subgroup.

The ABO blood type of 9 pedigree members were determined by serological methods. Exons 6 and 7 of the ABO gene were amplified by PCR and directly sequenced. The patient and her father were also subjected to clone sequencing analysis.

Serological tests demonstrated that the proband and her younger brother had an ABw subtype, whilst her father and two daughters had Bw subtype. Clone sequencing found that the exon 7 of the ABO gene of the proband had a T>C substitution at position 695, which was identified as a BW.11 allele compared with the reference sequence B.01. This BW.11 allele was also identified in the proband’s father, brother and two daughters. Due to allelic competition, the A/BW.11 and BW.11/O alleles demonstrated significantly different phenotypes.

The c.695T>C substitution of the ABO gene may lead to allelic competition in the Bw11 subtype. Combined molecular and serological methods is helpful for precise blood grouping.